View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10802_low_22 (Length: 238)
Name: NF10802_low_22
Description: NF10802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10802_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 13215020 - 13215233
Alignment:
| Q |
16 |
aattagatgtgagctagcactaggtggttcaaagattattcaaatgcaactaaaacaagttttgacatttccaagacgcagaacatatcagatttgaagc |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13215020 |
aattagatgcgagctagcactaggtggttcaaagattattcaaatgcaactaaaacaagttttgacatttccaagacgcagaacatatcagatttgaagc |
13215119 |
T |
 |
| Q |
116 |
agtaacttacatgcacaaatcttccaaagacaataagactttataagtcatacatgacataagaaaaagatgtacctcatttgcaggctgatgattctgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13215120 |
agtaacttacatgcacaaatcttccaaagacagtaagactttataagtcatacatgacataagaaaaagatttacctcatttgcaggctgatgattctgg |
13215219 |
T |
 |
| Q |
216 |
tgccattttcatct |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13215220 |
tgccattttcatct |
13215233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University