View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10802_low_3 (Length: 422)
Name: NF10802_low_3
Description: NF10802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10802_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 7 - 409
Target Start/End: Original strand, 45548586 - 45548988
Alignment:
| Q |
7 |
ataaaaaacttccatagtatggttgtcatattcaatcagcgctccttgaatgtgcaatattctttggcgatctcatccagaagtatactaaggatatgct |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548586 |
ataaaaaactttcatagtatggttgtcatattcaatcagcgctccttgaatgtgcaatattctttggcgatctcatccagaagtatactaaggatatgct |
45548685 |
T |
 |
| Q |
107 |
tttctgtatcccttataacatcatatttttcgataaatgcagatgtctcatcattccaacctaaatcccacatgcaatctatgtcaggccatttttcgta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45548686 |
tttctgtatcccttataacatcatatttttcgataaatgcagatgtctcatcattccaacctaaatcccacatgcaatctatgtcaggccatttttcata |
45548785 |
T |
 |
| Q |
207 |
gatatcatgctcaagcatcttaggcaggcattcctcaacatcaactttgctactctttttccttccgtagaatttaatcttctccatgtcctcgttcagc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548786 |
gatatcatgctcaagcatcttaggcaggtagtcctcaacatcaactttgctactctttttccttccgtagaatttaatcttctccatgtcctcgttcagc |
45548885 |
T |
 |
| Q |
307 |
ttcttaaccaagtcatctagagatcttatcaagttaacagtactagtgattgatgatatttttgaccaagtatgaattttgagttcctgccgtatcccct |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45548886 |
ttcttaaccaagtcatctagagatcttatcaagttaacagtactagtgattgatgatatttttgaacaagtatgaactttgagttcctgccgtatcccct |
45548985 |
T |
 |
| Q |
407 |
ttc |
409 |
Q |
| |
|
||| |
|
|
| T |
45548986 |
ttc |
45548988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University