View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10805_high_4 (Length: 241)
Name: NF10805_high_4
Description: NF10805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10805_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 46 - 107
Target Start/End: Original strand, 7781513 - 7781574
Alignment:
| Q |
46 |
aatataatgtactattagagaatggatttccttcatatgggtattgtttcttctgtacagat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
7781513 |
aatataatgtactattagagaatggatttccttcatatgggtattgtttcttttgtagagat |
7781574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 182
Target Start/End: Original strand, 7781595 - 7781631
Alignment:
| Q |
146 |
ttctcctctatttcttgttagaatcctaatttccaaa |
182 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
7781595 |
ttctcctgtatttcttgtcagaatcctaatttccaaa |
7781631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University