View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10805_low_15 (Length: 250)
Name: NF10805_low_15
Description: NF10805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10805_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 25974345 - 25974099
Alignment:
| Q |
1 |
ttatttgagcagattaaaatagcatgagggtttgtctctattgttttgannnnnnnnatgttcggtggttgatcttattgttgtaagttatcattctcga |
100 |
Q |
| |
|
||||||| | |||||||| |||||||||||||| ||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25974345 |
ttatttgtggagattaaattagcatgagggtttttctctattgttttgattttttt-atgtccggtggttgatcttattgtggtaagttatcattctcga |
25974247 |
T |
 |
| Q |
101 |
t----gaggtttaaaacttgatccatttcaaaatggaaaggttttacctaatttttt----atgctcaaaggtggaacgtgttgttgtaagctctcttcc |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
25974246 |
tcgatgaggtttaaaacttgatccatttcaaaatggaaaggttttacctaattttttttttatactcaaaggtggaacttgttgtggtaagctctcttcc |
25974147 |
T |
 |
| Q |
193 |
tcgatgaggcttaaaatgtatcagttgtgggatgaatttttacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25974146 |
tcgatgaggcttaaaatgtatcagttgtgggatgaatttttacctatg |
25974099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University