View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10805_low_26 (Length: 218)
Name: NF10805_low_26
Description: NF10805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10805_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 76 - 200
Target Start/End: Complemental strand, 13435588 - 13435467
Alignment:
| Q |
76 |
gagttacaaaattgaactaaacacacctcaaaatcaaaacaaaatataaccttgcaaactcatattcatcagggaagttgttgatgttgttgtgtgcttt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
13435588 |
gagttacaaaattgaactaaacacacctcaaaatcgaaacaaaatataaccttgcaaactcatattcattagggaagttgt---tgttgttgtgtgcttt |
13435492 |
T |
|
| Q |
176 |
gggttctttaattgagtgatgaatt |
200 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
13435491 |
gggttcttcaattgagtgatgaatt |
13435467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 13435650 - 13435617
Alignment:
| Q |
15 |
cataggaagttggggttcttcaatttcataggaa |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
13435650 |
cataggaagttggggttcttcaatatcataggaa |
13435617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 76 - 200
Target Start/End: Original strand, 31027839 - 31027958
Alignment:
| Q |
76 |
gagttacaaaattgaactaaacacacctcaaaatcaaaacaaaatataaccttgcaaactcatattcatcagggaagttgttgatgttgttgtgtgcttt |
175 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||| |||| |||||||||||| | | |
|
|
| T |
31027839 |
gagttacaaaattgaactaaacacacgtcaaaatcgaaacaaaatataaacttgcaaactcagattcattagg------gttgttgttgttgtgtgttct |
31027932 |
T |
|
| Q |
176 |
gggttctt-taattgagtgatgaatt |
200 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
31027933 |
gggttcttcaaattgagtgatgaatt |
31027958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 78 - 158
Target Start/End: Original strand, 31034741 - 31034821
Alignment:
| Q |
78 |
gttacaaaattgaactaaacacacctcaaaatcaaaacaaaatataaccttgcaaactcatattcatcagggaagttgttg |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| | |||||| ||| |||||||| |
|
|
| T |
31034741 |
gttacaaaattgaactaaacaaacctcaaaatcgaaacaaaatataaacttgcaaacttagattcatttgggtagttgttg |
31034821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University