View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10806_high_4 (Length: 251)
Name: NF10806_high_4
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10806_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14729262 - 14729509
Alignment:
| Q |
1 |
ttatgatgtttaat-atttagcacttacaatcaacctttctttctctt----atgcctgttatatgcatgtaacttgaaattcttctgtcaaattttata |
95 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14729262 |
ttatgatgtttaattatttagcacttacaatcaacctttctttctctttgttatgcctgttatatgcatgtaacttgaaattctt--gtcaaattttata |
14729359 |
T |
|
| Q |
96 |
ttgtaattatgnnnnnnnnnn-caataaaataatttctatacatatagtaatttgactttaagagcatcaggaatgttgtttctgttactaaaacttgag |
194 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14729360 |
ttgtaattatgtttttttttatcaataaaataatttctatacatatagtaatttgactttaagagcatcaggaatgttgtttctgttactaaaacttgag |
14729459 |
T |
|
| Q |
195 |
atagttgcatctgcatgcgcgctgttctttggtttttattgttcttctct |
244 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14729460 |
atagttgaatctgcatgcgcgctgttctttggtttttattgttcttctct |
14729509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University