View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10806_high_9 (Length: 239)
Name: NF10806_high_9
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10806_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14729263 - 14729039
Alignment:
| Q |
1 |
aattcagaagatttcaggacataaaagtacatgcaatatgcatta-attaactaggtatggacaccagcatatacatacatatacccaatactaaataaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14729263 |
aattcagaagatttcaggacataaaagtacatgcaatatgcattacattaactaggtatggacaccagcatatacatacatatacccaatactaaataaa |
14729164 |
T |
|
| Q |
100 |
gccgataaaaatggacaggccattctcagtgaacatcaaaattatttagttttctttaaaaatcaatgtatattcatgttaataagtaacaagcccatca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14729163 |
gccgataaaaatggacaggccattctcagtgaacatcaaaattatttagttttctttataaatcaatgtatattcatgttaataagtaacaagcacatca |
14729064 |
T |
|
| Q |
200 |
aagaaggaaagagtgtcacaaatct |
224 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
14729063 |
aagaaggaaacagtgtcacaaatct |
14729039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University