View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10806_low_11 (Length: 241)
Name: NF10806_low_11
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10806_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 38029270 - 38029045
Alignment:
| Q |
4 |
ttatcgacgactttaacccttagtaattaccgatggcttaagacccttgataatggtcatgcctctttctaaccactgacacctaaggtccccagtaaca |
103 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
38029270 |
ttatcgatgactttgacccttagtaattatcgatggcttaagacccttgataatggtcatgcctctttctaaccaccgacacctaaggtccctggtaaca |
38029171 |
T |
|
| Q |
104 |
ataatatttttaattgaaaattgtcttgaatgtcagtgacaacaatatttctttaaaattgcataagattatcctctaagaatcgagttcaact-----t |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38029170 |
ataatatttttaattgaaatttgtcttgaatgtcggtgataacaatatttctttaaaattgcataagattatcctctaagagtcgagttcaactcccgcc |
38029071 |
T |
|
| Q |
199 |
ccgcagaaggaaaatacttgctaaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38029070 |
ccgcagaaggaaaatacttgctaaat |
38029045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University