View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10806_low_14 (Length: 226)
Name: NF10806_low_14
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10806_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 15420190 - 15419978
Alignment:
| Q |
1 |
ttcataatgatcttaattaaacatgatgttatagtcattttactataaacatttgaagttttgaattgttggtatgcactacttgtaacattttagctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420190 |
ttcataatgatcttaattaaacatgatgttatagtcattttactataaacatttgaagttttgaattgttggtatgcactacttgtaacattttagctgc |
15420091 |
T |
|
| Q |
101 |
tacatttgttggcgaccacataagttcaaacattgattcaaagattagtacatggttttcataacaaaattatgtattacttataataattaacttatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420090 |
tacatttgttggcgaccacataagttcaaacattgattcaaagattaatacatggttttcataacaaaattatgtattacttataataattaacttatct |
15419991 |
T |
|
| Q |
201 |
ttgaacacaggtt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15419990 |
ttgaacacaggtt |
15419978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University