View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10806_low_15 (Length: 223)
Name: NF10806_low_15
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10806_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 36 - 210
Target Start/End: Complemental strand, 41639618 - 41639444
Alignment:
| Q |
36 |
tgttacacattgaccagaaggaaatgagataaattaatatgataatcgattaattttgtattattataaagaattgaatagtggattgcacgtaaagaac |
135 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41639618 |
tgttacacattgaccagaagaaaatgagataaattaatatgataatcgattaattttgtattattataaagaattgaatagtggattgcacgtcaagaac |
41639519 |
T |
 |
| Q |
136 |
cgataggagtgcttcaccacgtttattcccaactcatactcacactaaccaacccctgcttagctggcttgttat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639518 |
cgataggagtgcttcaccacgtttattcccaattcatactcacactaaccaacccctgcttagctggcttgttat |
41639444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University