View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10806_low_8 (Length: 247)
Name: NF10806_low_8
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10806_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 21611923 - 21612138
Alignment:
| Q |
19 |
attgctgccctgccccttcctcaggcaagttaatgaagagcgaggttttaactttttaacctataatcgacgtcttgtcgcaatctttgacaatgctgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611923 |
attgctgccctgccccttcctcaggcaagttaatgaagagcgaggttttaactttttaacctataatcgacgtcttgtcgcaatctttgacaatgctgct |
21612022 |
T |
 |
| Q |
119 |
cttttttcatgtttccgacaggtgttaatttgggttgtcatacctaatcttggaggctcaaccattgcaaacacaaaaaatgtccttaggttcatcatca |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21612023 |
cttttttcatgtttgagacaggtgttaatttggattgtcatacctaatcttggaggctcaaccattgcaaacacaaaaaatgtccttaggttcatcatca |
21612122 |
T |
 |
| Q |
219 |
ttatccaatatttgcc |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21612123 |
ttatccaatatttgcc |
21612138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University