View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10808_high_2 (Length: 202)
Name: NF10808_high_2
Description: NF10808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10808_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 6578636 - 6578807
Alignment:
| Q |
14 |
taggcaataggcattgcattttttatttacattgagtcttacaaaaaggtaatacaataggaaagaaacatacactgtggagaaaagctttccttgcaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6578636 |
taggcaataggcattgcattttttatttacattgagtcttacaaaaaggtaatacaataggaaagaaacatacactgtggagaaaagctttccttgcaat |
6578735 |
T |
 |
| Q |
114 |
gtctgatattgtaagttgaccgtggctgcaggaaagagagtagattatcaacaataacatactttaattatg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6578736 |
gtctgatattgtaagttgaccgtggctgcaggaaagagagtagattatcaacaataacatacgataattatg |
6578807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 152
Target Start/End: Complemental strand, 34242043 - 34241975
Alignment:
| Q |
84 |
tacactgtggagaaaagctttccttgcaatgtctgatattgtaagttgaccgtggctgcaggaaagaga |
152 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||||||||||| | || ||||||||| || ||||| |
|
|
| T |
34242043 |
tacactgtaaagaaatgccttccttgcaatgtctgatattgtaatattactgtggctgcaagatagaga |
34241975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University