View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_high_1 (Length: 440)
Name: NF1080_high_1
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 51 - 205
Target Start/End: Complemental strand, 29843381 - 29843225
Alignment:
| Q |
51 |
atttgtgagtctagtaagtacaactcgaatgcattacacgtaatctcacctttcaaacaaaaaaattacacgtaatcttgtacc--cnnnnnnnnncatt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29843381 |
atttgtgagtctagtaagtacaactcgaatgcattacacgtaatcttacctttcaaacaaaaaaattacacgtaatcttgtaccaaaaaaaaaaaacatt |
29843282 |
T |
 |
| Q |
149 |
acacgtaaaaaagggtgttgtaaataagtttaatgcgtcggtctctggttctttgtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29843281 |
acacgtaaaaaagggtgttgtaaataagtttaatgcgtcggtctctggttttttgtt |
29843225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 332 - 411
Target Start/End: Complemental strand, 29843120 - 29843041
Alignment:
| Q |
332 |
atgtcctttcaatgtaaaatatttttacactgccgtgtaataatgagagatcacacaatactctttgatgtcacattagt |
411 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29843120 |
atgtcctttcaatgtaaaacatttttacactgctgtgtaataatgagagatcacacaatactctttgatgtcacattagt |
29843041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 256
Target Start/End: Complemental strand, 29843231 - 29843196
Alignment:
| Q |
221 |
ttttggtaggttttcaattgatattgattggatgct |
256 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29843231 |
ttttgttaggttttcaattgatattgattggatgct |
29843196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University