View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_low_10 (Length: 284)
Name: NF1080_low_10
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 60 - 121
Target Start/End: Original strand, 39731727 - 39731783
Alignment:
| Q |
60 |
attaaggaagcaacttttgttgacacactgatataggctagccattatcaggtttcattagc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39731727 |
attaaggaagcaacttttgttgacacactgata-----tagccattatcaggtttcattagc |
39731783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University