View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_low_11 (Length: 270)
Name: NF1080_low_11
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 36 - 221
Target Start/End: Original strand, 27937421 - 27937604
Alignment:
| Q |
36 |
atcatttgagaaaaaagaggaaaactagagtctaaagaaagagacccctaaccctaaggcattttgctaacaaagtaaacgcttagcaatggacggttgg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27937421 |
atcatttgagaaaaaagaggaaaactagagtctaaggaaagagacccctaaccctaaggcattt-gctaacaaagtaaacgcttagcaatggacggttgg |
27937519 |
T |
|
| Q |
136 |
tacttggtagcactcaaccttaaccgaaaatatcacttcaactactgcccttaactagagtagaactccaatattgggtgataagt |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27937520 |
tacttggtagcactcaac-ttaaccgaaaatatcacttcaactactgcccttaactagagtagaactccaattttgggtgataagt |
27937604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University