View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1080_low_12 (Length: 265)

Name: NF1080_low_12
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1080_low_12
NF1080_low_12
[»] chr3 (1 HSPs)
chr3 (43-241)||(33805475-33805673)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 43 - 241
Target Start/End: Complemental strand, 33805673 - 33805475
Alignment:
43 atattgaattcgattgatttatgtatacaatggatgaaaaactgcttattagtcactaattacatcaactgattcaatgtacaagagaaactactgtcgt 142  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33805673 atattgaattcgattgatttatgtatacaatggatgaaaaactgcttattagtcactaattacatcaactgattcaatgtacaagagaaactactgtcgt 33805574  T
143 gaattcgatgtgcatccatttgtaaactaaaatttcaaatatatcaatatacttctaactcaagatagtgtctcagtctaattcgaactcaagatctct 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||    
33805573 gaattcgatgtgcatccatttgtaaactaaaatttcaaatatatcaatatgcttctaactcaagatagtgtctcagtctaattcgaacttaagatctct 33805475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University