View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_low_12 (Length: 265)
Name: NF1080_low_12
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 43 - 241
Target Start/End: Complemental strand, 33805673 - 33805475
Alignment:
| Q |
43 |
atattgaattcgattgatttatgtatacaatggatgaaaaactgcttattagtcactaattacatcaactgattcaatgtacaagagaaactactgtcgt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33805673 |
atattgaattcgattgatttatgtatacaatggatgaaaaactgcttattagtcactaattacatcaactgattcaatgtacaagagaaactactgtcgt |
33805574 |
T |
 |
| Q |
143 |
gaattcgatgtgcatccatttgtaaactaaaatttcaaatatatcaatatacttctaactcaagatagtgtctcagtctaattcgaactcaagatctct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33805573 |
gaattcgatgtgcatccatttgtaaactaaaatttcaaatatatcaatatgcttctaactcaagatagtgtctcagtctaattcgaacttaagatctct |
33805475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University