View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_low_19 (Length: 220)
Name: NF1080_low_19
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 15465942 - 15466076
Alignment:
| Q |
1 |
atttgttctgatgttaaagaaaccatgcttccaaaggagatatacaccactgattgtgatggctttgaatttaaccaattaatgcaatcttcacttaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15465942 |
atttgttctgatgttaaagaaaccatgcttccaaaggagatatacaccactgattgtgatggctttgaatttaaccaattaatgcaatattcacttaatg |
15466041 |
T |
|
| Q |
101 |
gcttccataagtttgctccataccctttgtctcct |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15466042 |
gcttccataagtttgctccataccctttgtctcct |
15466076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 15474085 - 15474219
Alignment:
| Q |
1 |
atttgttctgatgttaaagaaaccatgcttccaaaggagatatacaccactgattgtgatggctttgaatttaaccaattaatgcaatcttcacttaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15474085 |
atttgttctgatgttaaagaaaccatgcttccaaaggagatatacactactgattgtgatggctttgcatttaaccaattaatgcaatcttcacttaatg |
15474184 |
T |
|
| Q |
101 |
gcttccataagtttgctccataccctttgtctcct |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15474185 |
gcttccataagtttgctccataccctttgtctcct |
15474219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University