View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_low_22 (Length: 208)
Name: NF1080_low_22
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 47608966 - 47609137
Alignment:
| Q |
16 |
ataccaaaccagcatttaatcactaatttcaataacaaactgcaaaccaaatcccactctagtagcataccctaccttgtagcataggccttcatacaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47608966 |
ataccaaaccagcatttaatcactaatttcaataacaaactgcaaaccaaatcccactctagtagcataccctaccttgtagcataggccttcatacaac |
47609065 |
T |
 |
| Q |
116 |
gagattaagagatatatagtgagtgtttggattagattttaagacacaaataccacgtcccaatgtaatttc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
47609066 |
gagattaagagatatatagtgagtgtttggattagattttaagacacaaatactacgtcccaatgcaatttc |
47609137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 10 - 128
Target Start/End: Original strand, 47604332 - 47604450
Alignment:
| Q |
10 |
aataatataccaaaccagcatttaatcactaatttcaataacaaactgcaaaccaaatcccactctagtagcataccctaccttgtagcataggccttca |
109 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47604332 |
aataaaataccaaaccagcattcaatcactaatttcaatagcaaactgcaaaccaaatcccactttagtagcataccctaccttgtagcataggccttca |
47604431 |
T |
 |
| Q |
110 |
tacaacgagattaagagat |
128 |
Q |
| |
|
||||| |||||| |||||| |
|
|
| T |
47604432 |
tacaaagagatttagagat |
47604450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University