View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1080_low_5 (Length: 388)
Name: NF1080_low_5
Description: NF1080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1080_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 74 - 296
Target Start/End: Complemental strand, 50872474 - 50872257
Alignment:
| Q |
74 |
atgataaccagatgtatagaagcatgagaggtgaattaggaagacaaggtactaaacaagtgnnnnnnnnnnnnnnnnnnnnnnatgtcttgtcatgagt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50872474 |
atgataaccagatgtatagaagcatgagaggtgaattaggaagacaaggtactaaacaagtgttttttcttttcttttc-----atgtcttgtcatgagt |
50872380 |
T |
|
| Q |
174 |
gaaaattttgcatgctttgtgcattgaatgcaaggcatttcttcagtctattattttttcttctcttggtatttatttaaagttccaaaataattccctt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50872379 |
gaaaattttgcatgctttgtgcattgaatgcaaggcatttcttcagtctattattttttcttctcttggtatttatttaaagttccaaaataattccctt |
50872280 |
T |
|
| Q |
274 |
gtggattttctttatgtataaca |
296 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50872279 |
gtggattttctttatgtataaca |
50872257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University