View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10810_low_1 (Length: 378)
Name: NF10810_low_1
Description: NF10810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10810_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 38 - 363
Target Start/End: Complemental strand, 1896760 - 1896435
Alignment:
| Q |
38 |
tcagaaagcaatcaagtccataatgttctttagtgaatattgatgataaaagggttaaagggaatccctgaattcaagcattttagtctctgaaatccaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1896760 |
tcagaaagcaatcaagtccataatgttctttagtgaatattgatgataaaagggttaaagggaatccctgaattcaagcattttagtctctgaaatccaa |
1896661 |
T |
|
| Q |
138 |
ccgcactttggtatagttgtaaccgaaagggaagacctcatcatacatttttggtatttggtgtttgtgtcctcttccactccaagcaaaatggtgtagc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1896660 |
ccgcactttggtatagttgtaaccgaaagggaagacctcatcatacatttatggtatttggtgtttgtgtcctcttccactccaagcaaaatggtgtagc |
1896561 |
T |
|
| Q |
238 |
atagcaccatatgcatataattcacatattatacataaattattgctctcttttaaattttcaagtctttttatccttcttttagcttttgaacaaatgc |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1896560 |
atagcaccatatgcatataattcacatattatacataaattattgctctcttttaaattttcaagtctttatatccttcttttagcttttgaacaaatgc |
1896461 |
T |
|
| Q |
338 |
acgggtgtaatatattagactgtatg |
363 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1896460 |
acgggtgtaatatattagactgtatg |
1896435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University