View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10813_low_10 (Length: 238)
Name: NF10813_low_10
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10813_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 35829505 - 35829728
Alignment:
| Q |
1 |
cttatagcagaacagtattcaaccccctctcttattaagcaatttttataagaagnnnnnnnn-tcatggttttaaaacttgttagtttctcaaaacatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35829505 |
cttatagcagaacagtattcaaccccctctcttattaagcaatttttataagaagaaaaaaaaatcatggttttaaaacttgttagtttctcaaaacatg |
35829604 |
T |
 |
| Q |
100 |
tcatattttcatttaccaaaaccattataattctaatccttagttttatactttacaaagctgactcaggctgcaacaattctattacaacttcattagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35829605 |
tcatattttcatttaccaaaaccattataattctaatccttagttttatactttacaaagctgactcaggctgcaacaattctattacaacttcattagt |
35829704 |
T |
 |
| Q |
200 |
tcaaattccaccctatgatgttat |
223 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
35829705 |
tcaaatttcaccctatgatgttat |
35829728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University