View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10813_low_2 (Length: 317)
Name: NF10813_low_2
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10813_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 14 - 301
Target Start/End: Original strand, 48953218 - 48953505
Alignment:
| Q |
14 |
agactaaagatcattctgattggactgaatgggagaagaagtattttgagaattatggttcggatgtatgtgatgcagttggattgttgcaaagaatgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953218 |
agactaaagatcattctgattggactgaatgggagaagaagtattttgagaattatggttcggatgtatgtgatgcagttggattgttgcaaagaatgtt |
48953317 |
T |
|
| Q |
114 |
gatgaacactagacctgccttggttgtgggcatattagctctgtttatgctaagcatgtcaatgtccatgtcactacttatgattcatctcgtggatttg |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48953318 |
gatgaacactagacctgccttggctgtgggcatattagctctgtttatgctaagcatgtcaatgtccatgtcactacttatgattcatctcgtggagttg |
48953417 |
T |
|
| Q |
214 |
gcaaatacctcaatgataactttttcatcaatctaatttggaaccaaccagcgcctggtgaagaaaactgccagatgtgccatggatt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953418 |
gcaaatacctcaatgataactttttcatcaatctaatttggaaccaaccaacacctggtgaagaaaactgccagatgtgccatggatt |
48953505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University