View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10813_low_3 (Length: 312)
Name: NF10813_low_3
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10813_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 20 - 302
Target Start/End: Complemental strand, 41094296 - 41094014
Alignment:
| Q |
20 |
agaatgttggtcattgttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094296 |
agaatgttggtcattgttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgc |
41094197 |
T |
|
| Q |
120 |
tgttgagaattgaatccttcatagttactattattgtcatcttcaaaaggtcctcctactactactcctcctcctccaccagtggttggagattgatgat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094196 |
tgttgagaattgaatccttcatagttactattgttgtcatcttcaaaaggtcctcctactactactcctcctcctccaccagtggttggagattgatgat |
41094097 |
T |
|
| Q |
220 |
gtgactgctcttcctcaaacgagtctagagactccatagttgaattaccttagcttcggatcacaattctttccgttcctttg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41094096 |
gtgactgctcttcctcaaacgagtctagagactccatagttgaattaccttagcttcggatcacaattctttctgttcctttg |
41094014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University