View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10813_low_5 (Length: 250)
Name: NF10813_low_5
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10813_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 31646950 - 31647103
Alignment:
| Q |
1 |
tttcacagtgactcatatctttagagaagacaactctatttctaagggtttataaa-------agtgttatcatatccactagaaggcaacttcacgctt |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||| ||| |||||||||| | |||||||||||||||| ||| |
|
|
| T |
31646950 |
tttcacggtgactcatatctttagagaagacaattctatttttaacggtttataaattataaaagttttatcatatctattagaaggcaacttcacactt |
31647049 |
T |
 |
| Q |
94 |
taattgatcatataaggtggcaagaagctccaatcatcattaggtgagacctag |
147 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31647050 |
taattgattttataaggtggcaagaagctccaaacatcattaggtgagacctag |
31647103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 151 - 215
Target Start/End: Original strand, 31647148 - 31647213
Alignment:
| Q |
151 |
ataacatgttgggaatgcccaa-tttaggtttgtcacattttgataaggtttggggtatatttgac |
215 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31647148 |
ataacatgctgggaatgcccaactttaagtttgtcacattttgataaggtttggggtatatttgac |
31647213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University