View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10813_low_6 (Length: 250)

Name: NF10813_low_6
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10813_low_6
NF10813_low_6
[»] chr6 (1 HSPs)
chr6 (165-237)||(1792252-1792324)


Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 165 - 237
Target Start/End: Complemental strand, 1792324 - 1792252
Alignment:
165 tttgtccctagaaaatttgctaatacaaaaaactaatcatatagttcttttgtgataatttctcaatctgcct 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1792324 tttgtccctagaaaatttgctaatacaaaaaactaatcatatagttcttttgtgataatttctcaatctgcct 1792252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University