View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10813_low_7 (Length: 247)
Name: NF10813_low_7
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10813_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 179 - 243
Target Start/End: Complemental strand, 26427070 - 26427006
Alignment:
| Q |
179 |
aatacctagggtttgtttgttcattgcatatatatgtggttactttgtgtgaagaccctttgctt |
243 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26427070 |
aatacctagagtgtgtttgttcattgcatatatatttggttactttgtgtgaagaccctttgctt |
26427006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 26427225 - 26427147
Alignment:
| Q |
15 |
ttcttatattattagagctcataattgaatttaatttacttgttgtgtgtccttaattagggcttatgtaacactccaagtgaat |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||| ||||| |||| || ||||| ||||||||||||||||| |
|
|
| T |
26427225 |
ttcttatattattagagctcatagttgaatttaatt-acttgttttgtgttctta----ggtcttat-taacactccaagtgaat |
26427147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 28009627 - 28009664
Alignment:
| Q |
3 |
attgctgcaaagttcttatattattagagctcataatt |
40 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
28009627 |
attgttgcaatgttcttatattattagagctcataatt |
28009664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University