View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10813_low_9 (Length: 240)
Name: NF10813_low_9
Description: NF10813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10813_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 31646886 - 31646683
Alignment:
| Q |
1 |
ttttatacttactttcgatactacgccatatttttaacaagacagttgtaaataatattatgtttccttgagttttggcctagtcctttaaaacaannnn |
100 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||| |||||| |||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31646886 |
ttttatacttacttttgatattacgccagatttttaacaagatagttgtcaataatattatgttcccttgagttttggcttagtcctttaaaacaa-ttt |
31646788 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnnnataatatatt---ccctttgagtagtgttgtagatgaatgtgaaaagttgttgttgcagcctaacttatcctttgatacctc |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31646787 |
ttctttctttaatttttgataatatattattccctttgagtagtgttgtagatgaatgtgaaaagttgttgttgcagcctaacttatcttttgatacctc |
31646688 |
T |
 |
| Q |
198 |
tgtac |
202 |
Q |
| |
|
||||| |
|
|
| T |
31646687 |
tgtac |
31646683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University