View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10814_2 (Length: 376)
Name: NF10814_2
Description: NF10814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10814_2 |
 | |
|
| [»] scaffold0449 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 3051 - 3177
Alignment:
| Q |
1 |
aatggtacttcattaatctatttatagtgtaataggaaaagtgaaaggaaagttagttaaatctcaaacacaaattctgaaaagtctcccatttcatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3051 |
aatggtacttcattaatctatttatagtgtaataggaaaagtgaaaggaaagttagttaaatctcaaacacaaattctgaaaagtctcccatttcatagt |
3150 |
T |
|
| Q |
101 |
tgactcctcaaacatcataacttgatc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3151 |
tgactcctcaaacatcataacttgatc |
3177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0449; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 258 - 364
Target Start/End: Original strand, 3310 - 3416
Alignment:
| Q |
258 |
aaggaggaggttgagtgataatagattattcaataacacgtttactttatgaaaagctttataccactacatactactactgcatcaaagtaagttgact |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3310 |
aaggaggaggttgagtgataatagattattcaataatacgtttactttatgaaaaactttatatcagtacatactactactgcatcaaagtaagttgact |
3409 |
T |
|
| Q |
358 |
atatatt |
364 |
Q |
| |
|
||||||| |
|
|
| T |
3410 |
atatatt |
3416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University