View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10816_high_2 (Length: 351)
Name: NF10816_high_2
Description: NF10816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10816_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 99 - 335
Target Start/End: Complemental strand, 39147597 - 39147363
Alignment:
| Q |
99 |
ggatgattcggaatagttaaagatgnnnnnnnagttgagatggctcgtttgtaaatttttcattcatggtttttgaggtttcagatctattttgnnnnnn |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39147597 |
ggatgattcggaatagttaaagatgtttttt-agttgagatggctagtttgtaa-tttttcattcatggtttttgaggtttcagatctattttgtttttt |
39147500 |
T |
 |
| Q |
199 |
ngtgatctggatgatatgttccaaacattgatcagttgaagattcctttgtttannnnnnncttagcttaaaagggggtgattgaaatgaaaaaatttgt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39147499 |
tgtgatctggatgatatgttccaaacattgatcagttgaagattcctttgtttatttttttcttagcttaaaagggggtgattgaaatgaaaaaaattgt |
39147400 |
T |
 |
| Q |
299 |
cttttaattttagcatgattagaaattgcgcaattgc |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39147399 |
cttttaattttagcatgattagaaattgcgcaattgc |
39147363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 39147698 - 39147663
Alignment:
| Q |
1 |
cctattctataccaaatatcaaggtaaattgattga |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39147698 |
cctattctataccaaatatcaaggtaaattgattga |
39147663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University