View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10816_high_6 (Length: 222)

Name: NF10816_high_6
Description: NF10816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10816_high_6
NF10816_high_6
[»] chr4 (1 HSPs)
chr4 (17-206)||(2325844-2326033)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 2325844 - 2326033
Alignment:
17 atgaattgatagtaatagtatttatctgaaacagtttcatctt-----gcatgtggaagtactgctagcatgggaaagatattgcattgctgaaacagtt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||| ||||||||||||||||| |     ||||||||||    
2325844 atgaattgatagtaatagtatttatctgaaacagtttcatcttagcttgcatgtggaagtactgcaagcatgggaaagatattac-----tgaaacagtt 2325938  T
112 tatttatgtttatgaattatgagtactgtgattgtcctttccactatcactttctccgtacaactttcaggttactcttcaagcaaacatcaact 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2325939 tatttatgtttatgaattatgagtactgtgattgtcctttccactatcactttctccgtacaactttcaggttactcttcaagcaaacatcaact 2326033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University