View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10816_low_12 (Length: 222)
Name: NF10816_low_12
Description: NF10816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10816_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 2325844 - 2326033
Alignment:
| Q |
17 |
atgaattgatagtaatagtatttatctgaaacagtttcatctt-----gcatgtggaagtactgctagcatgggaaagatattgcattgctgaaacagtt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
2325844 |
atgaattgatagtaatagtatttatctgaaacagtttcatcttagcttgcatgtggaagtactgcaagcatgggaaagatattac-----tgaaacagtt |
2325938 |
T |
|
| Q |
112 |
tatttatgtttatgaattatgagtactgtgattgtcctttccactatcactttctccgtacaactttcaggttactcttcaagcaaacatcaact |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325939 |
tatttatgtttatgaattatgagtactgtgattgtcctttccactatcactttctccgtacaactttcaggttactcttcaagcaaacatcaact |
2326033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University