View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10816_low_7 (Length: 271)
Name: NF10816_low_7
Description: NF10816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10816_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 30526088 - 30525856
Alignment:
| Q |
14 |
caaagggaataattaataaatatctcaaaggccaccttgataattcattcaccttaattgaaaaggaaaaagaaatagatgctactagtgcaatggtgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30526088 |
caaagggaataattaataaatatctcaaaggccaccttgataattcattcaccttaattgaaaaggaaaaagaaatagatgctactagtgcaatggtgga |
30525989 |
T |
|
| Q |
114 |
ttgctttagttttgcttttcatggctaagaaatagaagatcctcttaatattagggttacatggcaatatcatattggttgatttaggtttatagtggga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30525988 |
ttgctttagttttgcttttcatggctaagaaatagaagatcctcttaatattagggttacatggcaatatcatattggttgatttaggtttatagtggga |
30525889 |
T |
|
| Q |
214 |
gtcaatttttcatatccacgagcatacagtgtttg |
248 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30525888 |
gtcaa--tttcatatccacgagtatacagtgtttg |
30525856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University