View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10817_low_5 (Length: 270)
Name: NF10817_low_5
Description: NF10817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10817_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 77 - 264
Target Start/End: Original strand, 42030237 - 42030434
Alignment:
| Q |
77 |
taggttctaaaataaattacacagtacataaaaattgatctcacgccacttaaaccaacccccttgttgtc----------acgccagattacatatatg |
166 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42030237 |
tagggtctaaaataaattacacagtacataaaaattgatctcacgccacttaacccaacccccttgttgtccacgcggaccacgccagattacatatatg |
42030336 |
T |
|
| Q |
167 |
gtaacgctcttaccccttgtccacgccaccttatattacgctcataaaccctttgtctgtcatcaataacacaaaaccctcttcacttttcttctctc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42030337 |
gtaacgctcttaccccttgtccacgccaccttatattacgctcataaaccctttgtctgtcatcaatatcacaaaaccctcttcacttttcttctctc |
42030434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 47
Target Start/End: Original strand, 42030184 - 42030212
Alignment:
| Q |
19 |
atacatacctattgtccaccagaatgcaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42030184 |
atacatacctattgtccaccagaatgcaa |
42030212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University