View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10818_high_12 (Length: 324)
Name: NF10818_high_12
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10818_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 109 - 253
Target Start/End: Original strand, 6444363 - 6444515
Alignment:
| Q |
109 |
tagttcttctgtgtgaaaccagtttgcactgcaatgtccactgtgacatttccaacaaacaaacactgatcgtaggcacatgat----tttctacttaga |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6444363 |
tagttcttgtgtgtgaaaccagtttgcactgcaatgtccactgtgacatttccaacaaacaaacactgatcgtatgcacatgattttctttctacttaga |
6444462 |
T |
 |
| Q |
205 |
gagtggtcctgtccttttt----cacacccatgtagtccttgcaatgttccat |
253 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
6444463 |
gagtggtcctgtcctttgtcacacacacacatgtagtccttgcaatgttccat |
6444515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 6444295 - 6444349
Alignment:
| Q |
27 |
gggttgagaagaacaggaaaatattattttagtggtcacgcaacatgattttcta |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6444295 |
gggttgagaagaacaggaaaatattattttagtggtcacgcaacatgattttcta |
6444349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 259 - 316
Target Start/End: Original strand, 6444574 - 6444632
Alignment:
| Q |
259 |
ccactctgcttcattatattgctgttgag-ttacaccttctcttccctttatctctgct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
6444574 |
ccactctgcttcattatattgctgttgagtttacaccttctcttccctttatgtctgct |
6444632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 29731290 - 29731252
Alignment:
| Q |
22 |
tgaatgggttgagaagaacaggaaaatattattttagtg |
60 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29731290 |
tgaatgggttgagaagaacagaaaaatattattttagtg |
29731252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 6653758 - 6653800
Alignment:
| Q |
22 |
tgaatgggttgagaagaacaggaaaatattattttagtggtca |
64 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
6653758 |
tgaatgggttgagaagaactgaaaaatattattttaatggtca |
6653800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 6734158 - 6734200
Alignment:
| Q |
22 |
tgaatgggttgagaagaacaggaaaatattattttagtggtca |
64 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
6734158 |
tgaatgggttgagaagaactgaaaaatattattttaatggtca |
6734200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University