View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10818_high_18 (Length: 257)
Name: NF10818_high_18
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10818_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 241
Target Start/End: Complemental strand, 20479920 - 20479685
Alignment:
| Q |
6 |
gagagaagaaaggttgagatatttaccatctccaagccggattagcttcgggagggcatcgtacccttgaagagtttgatgatatgaaagtattgtagtc |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479920 |
gagacaagaaaggttgagatatttaccatctccaagccggattagcttcgggagggcatcgtacccttgaagagtttgatgatatgaaagtattgtagtc |
20479821 |
T |
 |
| Q |
106 |
ttgcaataaatcagttcttcccactacagaatgacgnnnnnnnnnncataaatatatggacaaaatacaaatatctaattggatagtcaactctgaccta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20479820 |
ttgcaataaatcagttcttcccactacagaatgacgaaaaaaaaaacataaatatatggacaaaatacaaatatctaattgaatagtcaactctgaccta |
20479721 |
T |
 |
| Q |
206 |
tcaccacaactgcacttaggaaaccatattgaatgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479720 |
tcaccacaactgcacttaggaaaccatattgaatgt |
20479685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University