View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10818_high_27 (Length: 239)
Name: NF10818_high_27
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10818_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 51079008 - 51078799
Alignment:
| Q |
1 |
ttaagtcttgggtttcaaaagcattgcaatattttggggtgggggcagtttgaatgtttgctgtagcagtgtgatgtcaagttatttgttatcc--accc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
51079008 |
ttaagtcttgggtttcaaaagcattgcaatattttggggtgggggcagtttgaatgtttgctgtagca---------------atttgttatccccaccc |
51078924 |
T |
|
| Q |
99 |
cctttgaacttagttgcctaattgcattcgttctgttgcagaaatgctggtgagggagtaatgggctatgcttaagagaagcaatacatcttctgatgcc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51078923 |
cctttgaacttagttgcctaattgcatttgttctgttgcagaaatgctgttgagggagtaatgggctatgcttaagagaagcaatacatcttctgatgcc |
51078824 |
T |
|
| Q |
199 |
tgcgggcaaaaacaatgttcatttg |
223 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
51078823 |
tgtgggcaaaaacaatgttcatttg |
51078799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University