View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10818_high_38 (Length: 209)

Name: NF10818_high_38
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10818_high_38
NF10818_high_38
[»] chr8 (1 HSPs)
chr8 (14-181)||(3916106-3916273)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 3916273 - 3916106
Alignment:
14 caaaggatggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgttt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3916273 caaaggatggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgttt 3916174  T
114 gttttggcctttgttttgccctgattatcaaaagatgtgtctttattacaaagccacagaagaagaag 181  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
3916173 gttttggcctttgttttgtcctgattatcaaaagatgtgtctttattacaaagccacagaagaagaag 3916106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University