View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10818_high_5 (Length: 415)
Name: NF10818_high_5
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10818_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 142 - 380
Target Start/End: Complemental strand, 17987864 - 17987626
Alignment:
| Q |
142 |
aatctgaataactttatcttttaatttgaaattttggtgtagttaactcttgtggaaattgatgcttcacaatctgaagaagaatattggaaatccgttt |
241 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17987864 |
aatctgaataactttttcttttaatttgaaattttggtgtagttaactcttgtggaaattgatgcttcacaatctgaagaagaatattggaaatccgttt |
17987765 |
T |
|
| Q |
242 |
ggccaaacacttctatgccgaagactctcctcgacctatttatttcgggttagaccccctttgttatttttgattgtctatattttagaaatattgttac |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17987764 |
ggccaaacacttctatgccgaagactctcctcgacctgtttatttcgggttagaccccttttgttatttttgattgtctatattttagaaatattgttac |
17987665 |
T |
|
| Q |
342 |
caattatgccatgatttcaatgttcaaggttaaattatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17987664 |
taattatgccatgatttcaatgttcaaggttacattatg |
17987626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 17988046 - 17987935
Alignment:
| Q |
1 |
aaagtcgaatcgagtttcgacttattcaatttttatcgagtcgatccaagctgaatctgatttggctcaggtcgactctttctagccttggaaattatat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
17988046 |
aaagtcgagtcgagtttcgacttattcaatttttatcgagttgatccaagctgaatctgatttggctcggctcgactctttctagccttggaaattatat |
17987947 |
T |
|
| Q |
101 |
acatcatgaaat |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17987946 |
acatcatgaaat |
17987935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 203 - 270
Target Start/End: Original strand, 17105978 - 17106045
Alignment:
| Q |
203 |
atgcttcacaatctgaagaagaatattggaaatccgtttggccaaacacttctatgccgaagactctc |
270 |
Q |
| |
|
||||||||||||| | ||||| ||||||||| || |||||||||||||| ||||||| ||| ||||| |
|
|
| T |
17105978 |
atgcttcacaatcgggggaagattattggaaaaccatttggccaaacactcctatgcctaaggctctc |
17106045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University