View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10818_low_37 (Length: 252)
Name: NF10818_low_37
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10818_low_37 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 65 - 252
Target Start/End: Original strand, 36409453 - 36409646
Alignment:
| Q |
65 |
ttttgtctatgatccatccacttacataccggtttctcaata-gnnnnnnntcgcaatcatttcttgctggggtcctcgagactttgaactatgaccggg |
163 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36409453 |
ttttttctatgatccatccacttacataccggtttctcaatttgaaaaaaatcgcaatcatttcttgctggggtcctcgagactttgaactatgaccggg |
36409552 |
T |
|
| Q |
164 |
gtggaaatccaatttgataggatagacc-----aatggaagaaagaaaggatcaatttgaatatgaaaataaactttatgaaaagtgaaaggat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36409553 |
gtggaaatccaatttgataggatagaccaatggaatggaagaaagaaagaatcaatttgaatatgaaaataaactttatgaaaagtgaaaggat |
36409646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 34 - 71
Target Start/End: Original strand, 36409403 - 36409440
Alignment:
| Q |
34 |
tattgaaaatgagtttaactttagccaaaacttttgtc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36409403 |
tattgaaaatgagtttaactttagccaaaacttttgtc |
36409440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University