View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10818_low_51 (Length: 238)
Name: NF10818_low_51
Description: NF10818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10818_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 23583859 - 23584074
Alignment:
| Q |
10 |
aagcagagaacccagcatgtcaaagaggatagtctattcacaatacatgtatcagtaagatggtcaaaacgccccacgatgcttgataagtttcaaacta |
109 |
Q |
| |
|
|||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
23583859 |
aagccgagaagccagcatgtcgaagaggatagtctattcacaatacatgtatcagtaagatggtcaaaacgccccacgatgcttgaaaagtttcaaatta |
23583958 |
T |
|
| Q |
110 |
cttaattttatctatataaattatgacaattattgacttgttatgcaaggaacctgatgataatcctccaatttagtctgaatattagatatctagatca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
23583959 |
cttaattttatctatataaattatgacagttattgacttgttatgcaaggaacctgatgataatccttcaatttagtctgaatattagatagctagatca |
23584058 |
T |
|
| Q |
210 |
tgagtggaaattcatg |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23584059 |
tgagtggaaattcatg |
23584074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University