View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10819_high_4 (Length: 245)
Name: NF10819_high_4
Description: NF10819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10819_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 34 - 230
Target Start/End: Complemental strand, 22853961 - 22853766
Alignment:
| Q |
34 |
ttctaatttatttgtatgttataannnnnnnaaggtttaatcttactttttagagaatttgaccctatatgatagtctattaaaatggttagtaactata |
133 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22853961 |
ttctaatttatttgtatgttataatttttt-aaggtttaatcttactttttagagaatttgaccctatatgatagtctattaaaatggttagtaactata |
22853863 |
T |
|
| Q |
134 |
tgatttaacacaatgtacaaattaacataatgattgtaataaaaattaatttaggtttacttaaataggcaagtctgttcggcctaaaatggttttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
22853862 |
tgatttaacacaatgtacaaattaacataatgattgtaataaaaattaatttaggtttacttaaataagcaagtctgttcgacctaaaatgcttttt |
22853766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 65 - 126
Target Start/End: Complemental strand, 22819953 - 22819892
Alignment:
| Q |
65 |
aaggtttaatcttactttttagagaatttgaccctatatgatagtctattaaaatggttagt |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
22819953 |
aaggtttaatctgactttttagagaattcgacctgatatagtagtctattaaaatggttagt |
22819892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 42
Target Start/End: Complemental strand, 22854378 - 22854341
Alignment:
| Q |
5 |
aagaaacatagaaatagatagcatgaactttctaattt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22854378 |
aagaaacatagaaatagatagcatgaactttctaattt |
22854341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University