View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10819_low_7 (Length: 256)
Name: NF10819_low_7
Description: NF10819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10819_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 32054690 - 32054935
Alignment:
| Q |
11 |
cataggtactacaaatggtacaaatcttagagtgaggaatcccaggtctccgtcttnnnnnnnnnnnnnnnnnnnnnnntcttccagatgccgtactcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32054690 |
cataggtactacaaatggtacaaatcttagagtgaggaatcccaggtctccgtcgtccaccactaccaccaccaccacctcttccagatgccgtactcac |
32054789 |
T |
|
| Q |
111 |
atcatcatagctcaaactatacgctgaacgatcatctccaccggtccttgaccgaggactttttgtactcccatttgcatggctaaattgaggagggtca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32054790 |
atcatcatagctcaaactatacgctgaatgatcatctccaccggtccttgaccgaggactttttgtactcccatttgcatggctaaattgaggagggtca |
32054889 |
T |
|
| Q |
211 |
tgaacatgtacatgtacatgcacatgctcacgattctcctcgattc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32054890 |
tgaacatgtacatgtacatgcacatgctcacgattctcctcgattc |
32054935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University