View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10820_low_16 (Length: 225)
Name: NF10820_low_16
Description: NF10820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10820_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 16 - 133
Target Start/End: Original strand, 41067422 - 41067539
Alignment:
| Q |
16 |
aggggaatatgattatcaaaatcattgtgaaatctgatcataacacaaaaaagaattacaaaaaattggttaaacacattgcactaggttatgtttttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41067422 |
aggggaatatgattatcaaaatcattgtgaaatctgatcataacacaaaaaagaattacaaaaaattggttaaaaacattgcactaggttatgtttttat |
41067521 |
T |
|
| Q |
116 |
aacattatcattgtttgt |
133 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41067522 |
aacattatcattgtttgt |
41067539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University