View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10820_low_17 (Length: 201)

Name: NF10820_low_17
Description: NF10820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10820_low_17
NF10820_low_17
[»] chr4 (1 HSPs)
chr4 (2-201)||(54504983-54505179)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 2 - 201
Target Start/End: Original strand, 54504983 - 54505179
Alignment:
2 gtcaaagtcgccttcagtaccctcagagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggccccgtcatcttcaccttcagacgag 101  Q
    ||||||||||||||||   ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
54504983 gtcaaagtcgccttca---ccctccgagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggcaccgtcatcttcaccttcagacgag 54505079  T
102 tcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgttcttaa 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54505080 tcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgttcttaa 54505179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University