View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10821_high_30 (Length: 244)

Name: NF10821_high_30
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10821_high_30
NF10821_high_30
[»] chr2 (1 HSPs)
chr2 (14-233)||(9085305-9085524)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 233
Target Start/End: Original strand, 9085305 - 9085524
Alignment:
14 acatatgttatgagatggattggtttaggcttaccctaaaaaattaaaacaccaagatatttaaagggtaattcacctgctacaaatcccaaagttttag 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9085305 acatatgttatgagatggattggtttaggcttaccctaaaaaattaaaacaccaagatatttaaagggtaattcacctgctacaaatcccaaagttttag 9085404  T
114 cagtatcagttttctcggataatggccaagagcatgagtaacaatttagagaact-atgtgccccccaaatgtttcaccatactgtcttaacagaaccat 212  Q
    ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||  ||||||||||||||    
9085405 cagtatcagttttcttggataatggccaagagcatgagtaa-aatttagagaactaatgtgccccccaaatgtttcaccatactaccttaacagaaccat 9085503  T
213 tatagagttcagatacttctt 233  Q
    |||||||||||||||||||||    
9085504 tatagagttcagatacttctt 9085524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University