View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_high_34 (Length: 240)
Name: NF10821_high_34
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_high_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 28183206 - 28183428
Alignment:
| Q |
18 |
tgcaattcgcaactgtcagcattatgtttgtttcaaaattttactatttgtattaatannnnnnnnctnnnnnnntagagacaatgaatcacaaaaatgt |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
28183206 |
tgcaattcgcaactgtcaccattatgtttgtttcaaaattttactatttgtattaatattttttttctaaaaaaatagagacaatgaatcacaaaaatgt |
28183305 |
T |
 |
| Q |
118 |
aatacatattttcatggttgaaagtaaacactatttattcatggnnnnnnnncaccatttacatcaaagatcacgtatcatatgatatttgcacccaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28183306 |
aatacatattttcatggttgaaagtaaacactatttattcatggaaaaaaaacaccatttacatcaaagatcacgtatcatatgatatttgcacccaaag |
28183405 |
T |
 |
| Q |
218 |
ttttggcaaacaaatgaaattct |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28183406 |
ttttggcaaacaaatgaaattct |
28183428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University