View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_high_36 (Length: 240)
Name: NF10821_high_36
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_high_36 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 47534295 - 47534071
Alignment:
| Q |
17 |
acaattcctgataaa-gtgtagacgatcttgatcaaaagtaagcaaggtcatcaagcaatcaacacatctacgtaccttgcatgaagagcaatctacgta |
115 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47534295 |
acaattcctgataaaagcgtagacgatcttgatcaaaagtaagcaaggtcatcaagcaatcaacacatctacgtaccttgcatgaagagcaatctactta |
47534196 |
T |
|
| Q |
116 |
ctacttagtatgggctaactgttggaaaaaggctttataatgcatcttgccaataatcaaatgaaaggattctattcaagtcagaaaactattttgagag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534195 |
ctacttagtatgggctaactgttggaaaaaggctttataatgcatcttgccaataatcaaatgaaaggattctattcaagtcagaaaactattttgagag |
47534096 |
T |
|
| Q |
216 |
ctcctatctctcaaagtagaacatt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47534095 |
ctcctatctctcaaagtagaacatt |
47534071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University