View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_high_38 (Length: 238)
Name: NF10821_high_38
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 5233259 - 5233468
Alignment:
| Q |
16 |
gaccctactggaatttcattggtgaaaagaacataaagtttgattatttgattctaccaaattaccaaattaatatggtttaaattttatcattatattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5233259 |
gaccctactggaatttcattggtgaaaagaacataaagtttgattatttgattctaccaaattaccaaattaatatggtttaaattttattattatattc |
5233358 |
T |
|
| Q |
116 |
acgtgtgtaaagtgtttcatatttaacatcgatgctccatctttttctggtagttcaagtttacaccaaaagattggatgcagagatgttgtataattta |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233359 |
acgtgtgtaaaatgtttcatatttaacattgatgctccatctttttctggtagttcaagtttacaccaaaagattggatgcagagatgttgtataattta |
5233458 |
T |
|
| Q |
216 |
tactactact |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
5233459 |
tactactact |
5233468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 17129156 - 17129208
Alignment:
| Q |
16 |
gaccctactggaatttcattggtgaaaagaacataaagtttgattatttgatt |
68 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| |||| || | |||||||| |
|
|
| T |
17129156 |
gaccctaccggaatttcactggtgaaaagaacatgaagtgtgctcatttgatt |
17129208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University