View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_15 (Length: 401)
Name: NF10821_low_15
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 31315669 - 31315889
Alignment:
| Q |
18 |
aattaagtcatgaaaacaccaaatgactcagcaaaaagtttattcaggtgcccttcgttggaagagaaaccaattatcagacctccctgttgtcaagaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31315669 |
aattaagtcatgaaaacaccaaatgactcagcaaaaagtttattcaggtgcccctcgttgtaagagaaaccaattatcagaccttcctgttgtcaagaag |
31315768 |
T |
|
| Q |
118 |
tagactgccaagaccaatgtcgctgaaagcaccatagttaccttcattaagatcactatgtctttaacagttgttatctattgctactatcaaagaattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31315769 |
tagactgccaagaccaatgtcgctgaaagcaccatagttaccttcattaagatcaccatgtctttaacagttgttatccattgctactatcaaagaattg |
31315868 |
T |
|
| Q |
218 |
tgattttatttaaggtgattc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31315869 |
tgattttatttaaggtgattc |
31315889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 240 - 300
Target Start/End: Original strand, 31315938 - 31315998
Alignment:
| Q |
240 |
aaagaacacactcatcagttatattttctagaagggaaatgttaactagtgtctccggata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31315938 |
aaagaacacactcatcagttatattttctagaagggaaatgttaactagtgcctccggata |
31315998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University