View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10821_low_27 (Length: 322)
Name: NF10821_low_27
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10821_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 18 - 309
Target Start/End: Complemental strand, 10884176 - 10883885
Alignment:
| Q |
18 |
aattagatggtcacagtttcgagtagcgaaatcagcctcttgcaaatataagataaaaggctatcccatcatcaaggtagctttaaggaaccaagctgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10884176 |
aattagatggtcacagtttcgagtagcgaaatcagcctcttgcaaatataagataaaaggctatcccatcatcaaggtagctttaaggaaccaagctgtt |
10884077 |
T |
|
| Q |
118 |
attgttaatcagaagtaaattgagttggtatatggaattcgtaatcgacattctgaaagcttcttgttgaacaaaagagttcctgtgctagtaaagttcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10884076 |
attgttaatcagaagtaaattgagttggtatatggaattcgtaatcgacattctgaaagcttcttgttgaacaaaagagttcctgtgctagtaaagttcc |
10883977 |
T |
|
| Q |
218 |
acttttattatgtgctgctcagtcacactgttgtaaaatttacaacttgtttgtgttttatgatatttggtcaaatatttcatactgcatct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10883976 |
acttttattatgtgctgctcagtcacactgttgtaaaatttacaacttgcttgtgttttatgatatttggtcaaatatttcatactgcatct |
10883885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University